circad | circRNAs associated with diseases

hsa_circ_0002968
Gene	MAPK8	Organism	Human
Genome Locus	chr10:49609654-49618211:+	Build	hg19
Disease	Gliomas	ICD-10	Malignant neoplasm of Brain, unspecified (C71.9)
DBLink	Link to database	PMID	28236760
Experimental Method
Sample Type	Brain Tissues	Comparison	Five Glioblastoma Multiforme (GBM) and five normal brain specimens
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGAGCTCATGGATGCAAATC Reverse TTGTTGTCACGCTTGCTTCT	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Zhu, J, Ye, J, Zhang, L, Xia, L, Hu, H, Jiang, H, Wan, Z, Sheng, F, Ma, Y, Li, W, Qian, J, Luo, C (2017). Differential Expression of Circular RNAs in Glioblastoma Multiforme and Its Correlation with Prognosis. Transl Oncol, 10, 2:271-279.